RESUMO
Heterogeneous nuclear ribonucleoproteins (hnRNPs) are multifunctional proteins with integral roles in RNA metabolism and the regulation of alternative splicing. These proteins typically contain prion-like domains of low complexity (PrLDs or LCDs) that govern their assembly into either functional or pathological amyloid fibrils. To date, over 60 mutations targeting the LCDs of hnRNPs have been identified and associated with a spectrum of neurodegenerative diseases including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer's disease (AD). The cryo-EM structures of pathological and functional fibrils formed by different hnRNPs have been recently elucidated, including those of hnRNPA1, hnRNPA2, hnRNPDL-2, TDP-43, and FUS. In this review, we discuss the structural features of these amyloid assemblies, placing particular emphasis on scrutinizing the impact of prevalent disease-associated mutations mapping within their LCDs. By performing systematic energy calculations, we reveal a prevailing trend of destabilizing effects induced by these mutations in the amyloid structure, challenging the traditionally assumed correlation between pathogenicity and amyloidogenic propensity. Understanding the molecular basis of this discrepancy might provide insights for developing targeted therapeutic strategies to combat hnRNP-associated diseases.
Assuntos
Esclerose Amiotrófica Lateral , Demência Frontotemporal , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Príons , Humanos , Príons/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Esclerose Amiotrófica Lateral/genética , Esclerose Amiotrófica Lateral/metabolismo , Esclerose Amiotrófica Lateral/patologia , Demência Frontotemporal/genética , Demência Frontotemporal/metabolismo , Demência Frontotemporal/patologia , MutaçãoRESUMO
Amyotrophic lateral sclerosis (ALS) is a debilitating neurodegenerative disease characterized by loss of motor neurons. Human genetic studies have linked mutations in RNA-binding proteins as causative for this disease. The hnRNPA1 protein, a known pre-mRNA splicing factor, is mutated in some ALS patients. Here, two human cell models were generated to investigate how a mutation in the C-terminal low-complexity domain (LCD) of hnRNPA1 can cause splicing changes of thousands of transcripts that collectively are linked to the DNA damage response, cilium organization, and translation. We show that the hnRNPA1 D262V mutant protein binds to new binding sites on differentially spliced transcripts from genes that are linked to ALS. We demonstrate that this ALS-linked hnRNPA1 mutation alters normal RNA-dependent protein-protein interactions. Furthermore, cells expressing this hnRNPA1 mutant exhibit a cell aggregation phenotype, markedly reduced growth rates, changes in stress granule kinetics, and aberrant growth of neuronal processes. This study provides insight into how a single amino acid mutation in a splicing factor can alter RNA splicing networks of genes linked to ALS.
Assuntos
Esclerose Amiotrófica Lateral , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Doenças Neurodegenerativas , Humanos , Esclerose Amiotrófica Lateral/genética , Esclerose Amiotrófica Lateral/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Mutação , Splicing de RNA/genética , Fatores de Processamento de RNA/genéticaRESUMO
OBJECTIVE: Multisystem proteinopathy type 3 (MSP3) is an inherited, pleiotropic degenerative disorder caused by a mutation in heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1), which can affect the muscle, bone, and/or nervous system. This study aimed to determine detailed histopathological features and transcriptomic profile of HNRNPA1-mutated skeletal muscles to reveal the core pathomechanism of hereditary inclusion body myopathy (hIBM), a predominant phenotype of MSP3. METHODS: Histopathological analyses and RNA sequencing of HNRNPA1-mutated skeletal muscles harboring a c.940G > A (p.D314N) mutation (NM_031157) were performed, and the results were compared with those of HNRNPA1-unlinked hIBM and control muscle tissues. RESULTS: RNA sequencing revealed aberrant alternative splicing events that predominantly occurred in myofibril components and mitochondrial respiratory complex. Enrichment analyses identified the nuclear pore complex (NPC) and nucleocytoplasmic transport as suppressed pathways. These two pathways were linked by the hub genes NUP50, NUP98, NUP153, NUP205, and RanBP2. In immunohistochemistry, these nucleoporin proteins (NUPs) were mislocalized to the cytoplasm and aggregated mostly with TAR DNA-binding protein 43 kDa and, to a lesser extent, with hnRNPA1. Based on ultrastructural observation, irregularly shaped myonuclei with deep invaginations were frequently observed in atrophic fibers, consistent with the disorganization of NPCs. Additionally, regarding the expression profiles of overall NUPs, reduced expression of NUP98, NUP153, and RanBP2 was shared with HNRNPA1-unlinked hIBMs. INTERPRETATION: The shared subset of altered NUPs in amyotrophic lateral sclerosis (ALS), as demonstrated in prior research, HNRNPA1-mutated, and HNRNPA1-unlinked hIBM muscle tissues may provide evidence regarding the underlying common nuclear pore pathology of hIBM, ALS, and MSP.
Assuntos
Esclerose Amiotrófica Lateral , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Doenças Musculares , Humanos , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Esclerose Amiotrófica Lateral/genética , Poro Nuclear/metabolismo , Poro Nuclear/patologia , Músculo Esquelético/metabolismo , Corpos de Inclusão/metabolismo , Corpos de Inclusão/patologia , Doenças Musculares/metabolismo , Complexo de Proteínas Formadoras de Poros Nucleares/genética , Complexo de Proteínas Formadoras de Poros Nucleares/metabolismoRESUMO
The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.
Assuntos
Quadruplex G , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/química , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , DNA/metabolismo , Ribonucleoproteínas/metabolismo , Telômero/genética , Telômero/metabolismoRESUMO
OBJECTIVES: Tongue squamous cell carcinoma (TSCC) is a common cancer in the oral and maxillofacial region, which seriously endangers people's life and health.Heterogeneous nuclear ribonucleoprotein A2/B1(hnRNP A2/B1) is an RNA-binding protein that regulates the expression of a variety of genes and participates in the occurrence and development of a variety of cancers. This study aims to investigate the role of hnRNP A2/B1 in TSCC progression. METHODS: The differential expression of hnRNP A2/B1 in oral squamous cell carcinoma (OSCC) and normal oral mucosa cells and tissues was analyzed based on the gene expression profiles of GSE146483 and GSE85195 in the Gene Expression Omnibus (GEO) database. The correlation between hnRNP A2/B1 expression and disease-free survival of TSCC patients was analyzed based on TSCC related chip of GSE4676. TSCC cancer and paracancerous tissue samples of 30 patients were collected in Hunan Cancer Hospital from July to December 2021. Real-time RT-PCR and Western blotting were used to verify the mRNA and protein expression of hnRNP A2/B1 in TSCC patients'samples, respectively. Human TSCC Tca-8113 cells were transfected with hnRNP A2/B1 empty vector (a sh-NC group), knockdown plasmid (a sh-hnRNP A2/B1 group), empty vector overexpression plasmid (an OE-NC group) and overexpression plasmid (an OE-hnRNP A2/B1 group), respectively. The knockdown or overexpression efficiency of hnRNP A2/B1 was detected by Western blotting. The proliferation activity of Tca-8113 cells was detected by cell counting kit-8 (CCK-8), and the apoptosis rate of Tca-8113 cells was detected by flow cytometry. RESULTS: Based on the analysis of OSCC-related chips of GSE146483 and GSE85195 in the GEO database, it was found that hnRNP A2/B1 was differentially expressed in the OSCC and normal oral mucosa cells and tissues (all P<0.01). Meanwhile, the analysis of TSCC related chip GSE4676 confirmed that the expression of hnRNP A2/B1 was negatively correlated with the disease-free survival of TSCC patients (P=0.006). The results of real-time RT-PCR and Western blotting showed that the relative expression levels of hnRNP A2/B1 mRNA and protein in TSCC tissues were significantly up-regulated compared with those in adjacent tissues (all P<0.01). The results of Western blotting showed that the expression level of hnRNP A2/B1 in Tca-8113 cells was significantly inhibited or promoted after knockdown or overexpression of hnRNP A2/B1 (all P<0.01). The results of CCK-8 and flow cytometry showed that inhibition of hnRNP A2/B1 expression in Tca-8113 cells reduced cell proliferation activity (P<0.05) and increased cell apoptic rate (P<0.01). Overexpression of hnRNP A2/B1 in Tca-8113 cells significantly increased cell proliferation (P<0.05) and decreased cell apoptosis (P<0.01). CONCLUSIONS: HnRNP A2/B1 is a key factor regulating the proliferation and apoptosis of TSCC cells. Inhibition of hnRNP A2/B1 expression can reduce the proliferation activity of TSCC cells and promote the apoptosis of TSCC cells.
Assuntos
Carcinoma de Células Escamosas , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Neoplasias Bucais , Neoplasias da Língua , Humanos , Carcinoma de Células Escamosas/genética , Neoplasias da Língua/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , RNA Mensageiro , Língua/metabolismo , Linhagem Celular TumoralRESUMO
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
Our investigation to explore cellular alterations related to undernutrition in cancer cells revealed that the protein level of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1) is drastically decreased by serum/glucose starvation. Its loss was reversible, serum/glucose starvation-specific and universal throughout cell types and species. The hnRNP A1 mRNA level and hnRNP A1 mRNA/protein stability were not altered under this condition. CCND1 mRNA, which we newly identified as the binding target of hnRNP A1, was decreased by serum/glucose starvation. Under similar conditions, CCND1 protein was reduced in vitro and in vivo, whereas hnRNP A1 mRNA level and CCND1 mRNA level revealed no correlation in most clinical samples. Functional analyses revealed that CCND1 mRNA stability is certainly dependent on hnRNP A1 protein level and that RNA recognition motif-1 (RRM1) in hnRNP A1 plays a central role in maintaining CCND1 mRNA stability and subsequent protein expression. The injection of RRM1-deleted hnRNP A1-expressing cancer cells in the mouse xenograft model did not form any tumours, and that of hnRNP A1-expressing cancer cells retained CCND1 expression at the lesion adjacent to necrosis with a slight increase in tumour volume. Furthermore, RRM1 deletion caused growth suppression with the induction of apoptosis and autophagy, whereas CCND1 restoration completely recovered it. Our results indicate that serum/glucose starvation triggers entire hnRNP A1 protein loss, and its loss may play a role in CCND1 mRNA destabilization and CCND1-mediated cellular event inhibition, i.e. growth promotion, apoptosis induction and autophagosome formation.
Assuntos
Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Animais , Camundongos , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Ciclina D1/genética , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , GlucoseRESUMO
Breast cancer is a highly harmful malignant tumor, which poses a great threat to women's body and mind, and the mortality rate ranks second among all women's diseases. The incidence rate accounts for 7-10% of various malignant tumors in the whole body, second only to uterine cancer in women, and has become the main cause of threatening women's health. Advanced breast cancer is often considered an incurable disease. The family of heterogeneous nuclear ribonucleoprotein complexes is composed of about 20 hnRNP proteins with molecular weights ranging from 32 to 120 kDa, and they are named according to their molecular weights. Among them, hnRNPA2 and hnRNPB1 are the two most important members of the hnRNP family, both derived from the same gene on chromosome 7p15. Therefore, research to understand the molecular mechanism and process of breast cancer progression has an important role in promoting the current medical research on breast cancer treatment methods. Therefore, studying the mechanism of tumorigenesis is the key to tumor prevention and treatment. Therefore, this paper proposes that A2/B1 promotes the stability of NRF2 mRNA and inhibits ferroptosis and cell proliferation in breast cancer cells. The article mainly introduces the disease diagnosis method based on artificial neural network and its neural network algorithm. In the experimental part, the activity of hnRNP A2/B1 on cancer cells is deeply studied. The results show that the absorbance of the MTT method increases continuously with the extension of the culture time, and the maximum reaches 1.2. This fully shows that its absorption capacity is very strong, especially after 24 hours, the absorption rate rises from 0.6 to 0.9, which shows that 24 hours is the best absorption time. And it can also be found that hnRNPA2/B1 has a significant inhibitory effect on breast cancer cells; it can reduce the effect on breast cancer cell cycle and apoptosis.
Assuntos
Neoplasias da Mama , Ferroptose , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Feminino , Humanos , Neoplasias da Mama/genética , Neoplasias da Mama/patologia , Proliferação de Células/genética , Ferroptose/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Fator 2 Relacionado a NF-E2/genética , Fator 2 Relacionado a NF-E2/metabolismo , Estabilidade de RNARESUMO
The c-Myc oncoprotein plays a pivotal role in tumorigenesis. The deregulated expression of c-Myc has been linked to a variety of human cancers including lung adenocarcinoma. The oncogenic function of c-Myc has been largely attributed to its intrinsic nature as a transcription factor. Here we reported the RNA binding protein hnRNPAB as a direct transcriptional target of c-Myc by performing quantitative real-time polymerase chain reaction (qRT-PCR), western blot, chromatin immunoprecipitation (ChIP), and luciferase reporter analyses. Flow cytometry, colony formation, and RNA immunoprecipitation (RIP) assays were used to investigate the role of hnRNPAB in lung adenocarcinoma cell proliferation, as well as the underlying mechanism. HnRNPAB was functionally shown to promote lung adenocarcinoma cell proliferation by accelerating G1/S cell cycle progression. Mechanistically, hnRNPAB interacted with and stabilized CDK4 mRNA, thereby increasing CDK4 expression. Moreover, hnRNPAB was able to promote G1/S cell cycle progression and cell proliferation via the regulation of CDK4. HnRNPAB was also revealed as a mediator of the promoting effect of c-Myc on cell proliferation. Together, these findings demonstrate that hnRNPAB is an important regulator of lung adenocarcinoma cell proliferation. They also add new insights into the mechanisms of how c-Myc promotes tumorigenesis.
Assuntos
Adenocarcinoma de Pulmão , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Neoplasias Pulmonares , Humanos , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Proteínas Proto-Oncogênicas c-myc/genética , Proteínas Proto-Oncogênicas c-myc/metabolismo , Adenocarcinoma de Pulmão/genética , Proliferação de Células/genética , Neoplasias Pulmonares/patologia , Carcinogênese/genética , Linhagem Celular Tumoral , Regulação Neoplásica da Expressão Gênica , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Quinase 4 Dependente de Ciclina/genética , Quinase 4 Dependente de Ciclina/metabolismoRESUMO
The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.
Assuntos
Ribonucleoproteína Nuclear Heterogênea A1 , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , MicroRNAs , Neoplasias , Humanos , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/química , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas/genética , Neoplasias/genéticaRESUMO
Rationale: Bone destruction is a hallmark of multiple myeloma (MM) and affects more than 80% of patients. Although previous works revealed the roles of N6-methyladenosine (m6A) reader hnRNPA2B1 in the development of tumors, whether hnRNPA2B1 regulates bone destruction in MM is still unknown. Methods: Alizarin red S staining, TRAP staining, ELISA and quantitative real-time PCR assays were used to evaluate osteogenesis and osteoclastogenesis in vitro. X ray and bone histomorphometric analysis were preformed to identify bone resorption and bone formation in vivo. Exosome isolation and characterization were demonstrated by transmission electron microscopy, dynamic light scattering, immunofluorescence and flow cytometry assays. The interactions between hnRNPA2B1 and primary microRNAs were examined using RNA pull-down and RIP assays. Coimmunoprecipitation assay was used to test the interaction between hnRNPA2B1 and DGCR8 proteins. Luciferase assay was established to assess miRNAs target genes. Results: Here we show that myeloma cells hnRNPA2B1 mediates microRNAs processing and upregulates miR-92a-2-5p and miR-373-3p expression. These two microRNAs are transported to recipient monocytes or mesenchymal stem cells (MSCs) through exosomes, leading to activation of osteoclastogenesis and suppression of osteoblastogenesis by inhibiting IRF8 or RUNX2. Furthermore, clinical studies revealed a highly positive correlation between the level of myeloma cells hnRNPA2B1 and the number of osteolytic bone lesions in myeloma patients. Conclusions: This study elucidates an important mechanism by which myeloma-induced bone lesions, suggesting that hnRNPA2B1 may be targeted to prevent myeloma-associated bone disease.
Assuntos
Doenças Ósseas , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , MicroRNAs , Mieloma Múltiplo , Humanos , Mieloma Múltiplo/complicações , MicroRNAs/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , OsteogêneseRESUMO
OBJECTIVE: Flail arm syndrome (FAS) is one of the atypical subtypes of amyotrophic lateral sclerosis (ALS). Mutations in hnRNPA1 encoding heterogeneous nuclear ribonucleoprotein (hnRNP) A1 are a rare genetic cause of ALS. Herein, marked clinical heterogeneity of FAS in a pedigree with a known hnRNPA1 variant was described to raise early awareness of the ALS variant. Furtherly, a literature review of the hnRNPA1-related spectrum was made to summarize the clinical and genetic characteristics. METHODS: Detailed clinical evaluation, muscle pathology, and whole-exome sequencing were performed. The sequence and co-segregation of the mutation among the family members were confirmed by Sanger sequencing. RESULTS: The great clinical variability was found in a FAS pedigree. Muscle pathology revealed a cluster distribution of angulated or rounded atrophic fibers, accompanied by significant multi-nucleus aggregation. Immunohistochemical staining showed that mutant hnRNPA1 proteins accumulated in muscle fiber cytoplasm. Exome sequencing identified a documented variant in hnRNPA1 gene c.1018C > T (p.P340S), which co-segregated with disease in the family. Besides, highly phenotypic heterogeneity was also found in other hnRNPA1-related diseases. INTERPRETATION: We described a Chinese pedigree with hnRNPA1-related FAS, which showed significant clinical variability among the intrafamilial members. FAS is a relatively milder variant of ALS, due to the highly heterogeneous clinical spectrum, early observation is of paramount importance. In addition, the highly phenotypic heterogeneity and molecular genetic mechanism of the hnRNPA1-related spectrum are still beyond fully understood. Further, the detailed molecular mechanism underlying the clinical diversity is warranted to be explored.
Assuntos
Esclerose Amiotrófica Lateral , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Esclerose Amiotrófica Lateral/metabolismo , Mutação , Sequenciamento do ExomaRESUMO
Lung cancer in its occurrence and development of different stages exist different biological behavior changes. This paper studies the expression of heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1 in benign and malignant lung lesions and its early diagnosis value of nonsmall-cell lung cancer (NSCLC), aiming to provide reference for the early diagnosis and therapy of NSCLC. Some lung surgery specimens are selected from January 2021 to March 2022. All cases received no radiotherapy and chemotherapy before surgery, including 90 sufferers with benign lung lesions as the contrast set. hnRNP A2/B1 expressions are measured for comparison. The experimental results show that for lung cancer sufferers, the positive expression of hnRNP A2/B1 in their malignant lesion tissue is notoriously higher than that in their benign lesion tissue, and hnRNP A2/B1 is differently expressed in different differentiation and in different stages.
Assuntos
Carcinoma Pulmonar de Células não Pequenas , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Neoplasias Pulmonares , Humanos , Detecção Precoce de Câncer , Carcinoma Pulmonar de Células não Pequenas/patologia , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias Pulmonares/patologia , Pulmão/patologiaRESUMO
Heterogeneous nuclear ribonucleoproteins (hnRNPs) are a group of RNA-binding proteins with important roles in multiple aspects of nucleic acid metabolism, including the packaging of nascent transcripts, alternative splicing, transactivation of gene expression, and regulation of protein translation. As a core component of the hnRNP complex in mammalian cells, heterogeneous nuclear ribonucleoprotein A2B1 (hnRNP A2B1) participates in and coordinates various molecular events. Given its regulatory role in inflammation and cancer progression, hnRNP A2B1 has become a novel player in immune response, inflammation, and cancer development. Concomitant with these new roles, a surprising number of mechanisms deemed to regulate hnRNP A2B1 functions have been identified, including post-translational modifications, changes in subcellular localization, direct interactions with multiple DNAs, RNAs, and proteins or the formation of complexes with them, which have gradually made hnRNP A2B1 a molecular target for multiple drugs. In light of the rising interest in the intersection between cancer and inflammation, this review will focus on recent knowledge of the biological roles of hnRNP A2B1 in cancer, immune response, and inflammation.
Assuntos
Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Neoplasias , Animais , Humanos , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/química , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas/genética , Ribonucleoproteínas Nucleares Heterogêneas/metabolismo , RNA/metabolismo , Neoplasias/genética , Inflamação/genética , Mamíferos/genéticaRESUMO
Hepatocellular carcinoma (HCC) is one of the most frequent malignancies in the world. Although increasing evidence supports the role of heterogeneous ribonucleoprotein particle A1 (HNRNP A1) in tumor progression, the function of HNRNP A1 in HCC remains unclear. Here, we focused on the role of HNRNP A1 in the development of HCC. In this study, we found HNRNP A1 participates in many aspects of HCC, such as progression and prognosis. Our results showed that HNRNP A1 is upregulated in human HCC tissues and cell lines. High expression of HNRNP A1 can promote the proliferation, migration, and invasion in HCC cells and accelerate tumor progression in mice. Moreover, we found that HNRNP A1 prevents the senescence process of HCC cells. Knocking down of HNRNP A1 promotes the expression of P16INK4, which arrests the cell cycle and then induces the senescence phenotype in HCC cells. Furthermore, we found that HNRNP A1 regulated necroptosis and mitochondrial dynamics. In summary, our study indicates that HNRNP A1 promotes the development of HCC, which suggests a potential therapeutic target for HCC.
Assuntos
Carcinoma Hepatocelular , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Neoplasias Hepáticas , Animais , Carcinoma Hepatocelular/metabolismo , Ciclo Celular , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Humanos , Neoplasias Hepáticas/metabolismo , Camundongos , Dinâmica Mitocondrial , Necroptose , RibonucleoproteínasRESUMO
The heterogeneous nuclear ribonucleoprotein hnRNP A1 is a nucleocytoplasmic-shuttling RNA-binding protein that plays an important role in nucleic acid metabolism and gene expression regulation. The function of hnRNP A1 is determined in part by its specific location within the cell. Although some work has been done to elucidate the signaling pathways that regulate the cellular localization of hnRNP A1, the precise mechanism(s), including physiological and pathophysiological conditions that alter hnRNP A1 localization, are not known. We previously conducted an unbiased RNAi-based kinome-wide screen to identify kinases that regulate hnRNP A1 localization during hypertonic stress. One of the hits from this screen is AMPK-related protein kinase 5 (ARK5). Here, we validate ARK5 as the kinase responsible for controlling hnRNP A1 subcellular localization in response to hypertonic stress. We find using immunoprecipitation and in vitro kinase assay methods that ARK5 directly interacts with and phosphorylates hnRNP A1 on serine residues within the F-peptide region. We further show that the M9 motif of hnRNP A1 is essential for the ARK5-hnRNP A1 interaction and subsequent phosphorylation. In addition, the silencing of ARK5 increases the expression of antiapoptotic protein Bcl-xL and consequently delays caspase activation during hypertonic stress. Our results indicate that ARK5 phosphorylates hnRNP A1 and regulates its subcellular localization during hypertonic stress.
Assuntos
Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Ácidos Nucleicos , Proteínas Quinases Ativadas por AMP/metabolismo , Caspases/metabolismo , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas , Pressão Osmótica , SerinaRESUMO
Interaction of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) with specific single-stranded RNA and its relation to liquid-liquid phase separation (LLPS) were studied in vitro by magnetic resonance based on site-directed spin labelling. An ensemble model of dispersed hnRNP A1 in the absence of RNA was derived from distance distributions between spin labelled sites and small angle X-ray scattering. This model revealed a compact state of the low-complexity domain and its interaction with the RNA recognition motifs. Paramagnetic relaxation enhancement NMR spectroscopy confirmed this interaction. Addition of RNA to dispersed hnRNP A1 induced liquid-droplet formation. Such LLPS depended on RNA concentration and sequence, with continuous wave EPR spectroscopy showing an influence of RNA point mutations on local protein dynamics. We propose that an interplay of sequence-specific RNA binding and LLPS contributes to regulation of specific RNA segregation during stress response.
Assuntos
Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Sítios de Ligação , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/química , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Espectroscopia de Ressonância Magnética , RNA/metabolismoRESUMO
Some studies have suggested heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) to be a promoter in cancer development. Nonetheless, no detailed pan-cancer investigation has been reported. Thus, this study explored the possible oncogenic role of HNRNPA2B1, such as its expression levels, gene alteration, protein-protein interaction network, immune infiltration, and prognostic value in different cancer types using The Cancer Genome Atlas web platform. Many types of cancer exhibit HNRNPA2B1 overexpression, which is notably associated with poor prognosis. We also found that HNRNPA2B1 with different methylation levels causes a varied prognosis in lung adenocarcinoma (LUAD). It is noteworthy that HNRNPA2B1 levels are connected with cancer-associated fibroblasts in cancers, such as adrenocortical carcinoma, LUAD, and stomach adenocarcinoma. In addition, HNRNPA2B1 participates in the spliceosome- and cell cycle-associated pathways. Finally, HNRNPA2B1 is highly valued in the diagnosis of LUAD, lung squamous cell carcinoma, breast invasive carcinoma, esophageal carcinoma, and liver hepatocellular carcinoma. This systematic study highlighted the role of HNRNPA2B1 in pan-cancer progression.
Assuntos
Adenocarcinoma de Pulmão , Carcinoma Hepatocelular , Carcinoma Pulmonar de Células não Pequenas , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Neoplasias Hepáticas , Neoplasias Pulmonares , Adenocarcinoma de Pulmão/diagnóstico , Adenocarcinoma de Pulmão/genética , Adenocarcinoma de Pulmão/patologia , Carcinoma Hepatocelular/genética , Carcinoma Pulmonar de Células não Pequenas/genética , Regulação Neoplásica da Expressão Gênica , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Humanos , Neoplasias Hepáticas/genética , Neoplasias Pulmonares/diagnóstico , Neoplasias Pulmonares/genética , PrognósticoRESUMO
Cancer stem cells (CSCs) exhibit strong self-renewal capability to contribute to tumorigenesis in lung adenocarcinoma (LUAD). N6-methyladenosine (m6A) methylation is confirmed as a key mechanism for stemness acquisition and tumor growth. Heterogeneous nuclear ribonucleoprotein A2B1 (HNRNPA2B1) is a known m6A reader and is reported to participate in LUAD progression, but its relation with stemness of LUAD cells is unknown. Thus, this study aimed to uncover the effect of HNRNPA2B1 in stemness of LUAD cells. The association of HNRNPA2B1 with LUAD prognosis was analyzed via Gene Expression Profiling Interactive Analysis (GEPIA). Sphere formation, cytometry flow analysis and western blot of stemness-related genes were performed to examine the stemness of LUAD cells. m6A modification was investigated by RNA immunoprecipitation. Results depicted that HNRNPA2B1 was upregulated in LUAD CSCs. HNRNPA2B1 knockdown repressed cell stemness, proliferation, migration, and tumor growth of LUAD. As to mechanism, HNRNPA2B1 read the m6A site on primary microRNA-106b (pri-miR-106b) to facilitate the maturing of miR-106b-5p, so that miR-106b-5p targeted secreted frizzled-related protein 2 (SFRP2), activating Wnt/ß-catenin signaling. In conclusion, HNRNPA2B1 inhibits SFRP2 and activates Wnt-ß/catenin via m6A-mediated maturing of miR-106b-5p to aggravate stemness and LUAD progression, which potentially offered HNRNPA2B1 as a potential marker in CSCs-targeted treatment for LUAD.
Assuntos
Adenocarcinoma de Pulmão , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Neoplasias Pulmonares , MicroRNAs , Adenocarcinoma de Pulmão/patologia , Regulação Neoplásica da Expressão Gênica/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Humanos , Neoplasias Pulmonares/patologia , Proteínas de Membrana/metabolismo , MicroRNAs/metabolismo , beta Catenina/genética , beta Catenina/metabolismoRESUMO
Long intergenic non-protein coding RNA 1833 (LINC01833) exhibits elevated expression in the non-small cell lung cancer (NSCLC) tissues, while its molecular mechanism in NSCLC progression remains elusive. Herein, the proliferation, migration, invasion as well as apoptosis of NSCLC cells were assessed. The potential N6-methyladenosine (m6A) modification site was predicted by the m6aVar tool. RNA pulldown and m6A-specific immunoprecipitation assays were used to detect the interaction between LINC01833 and methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit (METTL3). RNA pull-down together with mass spectrometry were performed to assess the binding relationship between LINC01833 and heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) in NSCLC. Tumor xenograft mice model was established, and the tumor size and weight were measured. The results demonstrated that LINC01833 expression was elevated in NSCLC samples. Overexpression of LINC01833 promoted proliferative, migratory, and invasive abilities and inhibited HCC827 cell apoptosis. LINC01833 knockdown inhibited tumor growth in mice. LINC01833 is further demonstrated to be modulated by METTL3, which is highly expressed in NSCLC samples. In addition, RNA pulldown and m6A-specific immunoprecipitation assays indicated that LINC01833 might form a complex with HNRNPA2B1. In conclusion, m6A transferase METTL3-induced LINC01833 m6A methylation promotes NSCLC progression through modulating HNRNPA2B1 expression. Our findings indicated that LINC01833 might be a therapeutic target for NSCLC.